ID: 904594577_904594597

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 904594577 904594597
Species Human (GRCh38) Human (GRCh38)
Location 1:31635353-31635375 1:31635404-31635426
Sequence CCATAGGGCCCTCCACCAGCTGG CCCCCATAACCACCACCAGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 17, 4: 167} {0: 1, 1: 1, 2: 4, 3: 28, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!