ID: 904594591_904594595

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 904594591 904594595
Species Human (GRCh38) Human (GRCh38)
Location 1:31635389-31635411 1:31635403-31635425
Sequence CCTCCAGGGGCAGGACCCCCATA ACCCCCATAACCACCACCAGGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 1, 3: 17, 4: 152} {0: 1, 1: 1, 2: 6, 3: 28, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!