ID: 904603104_904603112

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 904603104 904603112
Species Human (GRCh38) Human (GRCh38)
Location 1:31684294-31684316 1:31684323-31684345
Sequence CCTGCACCCCTCTGAACACTCTG GAATGCTCCCACGTCAGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 212} {0: 1, 1: 0, 2: 3, 3: 37, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!