ID: 904618873_904618887

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 904618873 904618887
Species Human (GRCh38) Human (GRCh38)
Location 1:31763891-31763913 1:31763943-31763965
Sequence CCGTCAGCAGCAGGAGCGGGGGC AAGTTTGCCATCCCTAAGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 350} {0: 1, 1: 0, 2: 1, 3: 5, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!