ID: 904623060_904623064

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 904623060 904623064
Species Human (GRCh38) Human (GRCh38)
Location 1:31787112-31787134 1:31787144-31787166
Sequence CCAGCACACTTAAGGGGTCCCTC GCTTGCACAGTGCAAAGAACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 17, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!