ID: 904624366_904624370

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 904624366 904624370
Species Human (GRCh38) Human (GRCh38)
Location 1:31793746-31793768 1:31793764-31793786
Sequence CCTGTCCTGTGGTTCCGTGGGAG GGGAGACAACTCCCTGGTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 19, 4: 134} {0: 1, 1: 0, 2: 0, 3: 6, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!