ID: 904625461_904625472

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 904625461 904625472
Species Human (GRCh38) Human (GRCh38)
Location 1:31799656-31799678 1:31799674-31799696
Sequence CCTTCCCCCACCCCTTTGGGGAG GGGAGGAGCTATAGGCTGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 406} {0: 1, 1: 0, 2: 0, 3: 17, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!