ID: 904642097_904642110

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 904642097 904642110
Species Human (GRCh38) Human (GRCh38)
Location 1:31938487-31938509 1:31938529-31938551
Sequence CCCACCTGCCCCGCGGGGCGCTG TCCCCCGCTCCTCCTCCTCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 179} {0: 1, 1: 0, 2: 4, 3: 48, 4: 321}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!