ID: 904653037_904653038

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 904653037 904653038
Species Human (GRCh38) Human (GRCh38)
Location 1:32020545-32020567 1:32020562-32020584
Sequence CCAAAAACTGGAAACAAACCAAA ACCAAATGCCTCCAATAAACTGG
Strand - +
Off-target summary {0: 8, 1: 124, 2: 767, 3: 2480, 4: 5498} {0: 1, 1: 0, 2: 2, 3: 10, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!