ID: 904657540_904657546

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 904657540 904657546
Species Human (GRCh38) Human (GRCh38)
Location 1:32060531-32060553 1:32060553-32060575
Sequence CCTACCACCGTTTTCTGTTTCCC CCACTACCACACCTGTGTTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 215} {0: 1, 1: 0, 2: 0, 3: 9, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!