ID: 904657542_904657546

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 904657542 904657546
Species Human (GRCh38) Human (GRCh38)
Location 1:32060538-32060560 1:32060553-32060575
Sequence CCGTTTTCTGTTTCCCCACTACC CCACTACCACACCTGTGTTATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 42, 4: 480} {0: 1, 1: 0, 2: 0, 3: 9, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!