ID: 904659934_904659948

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 904659934 904659948
Species Human (GRCh38) Human (GRCh38)
Location 1:32076800-32076822 1:32076852-32076874
Sequence CCACCATCGTTCTGGGCCGCCGC TGGGTCCTAGAGGCTGGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 61} {0: 1, 1: 0, 2: 4, 3: 37, 4: 493}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!