|
Left Crispr |
Right Crispr |
| Crispr ID |
904662631 |
904662639 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:32096569-32096591
|
1:32096601-32096623
|
| Sequence |
CCTGCCTCGGGCCTCCCAAGTAG |
CAGGTGTGCACCACCACACCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 24, 2: 103, 3: 482, 4: 1779} |
{0: 1539, 1: 5896, 2: 24700, 3: 65088, 4: 142610} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|