ID: 904681909_904681924

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 904681909 904681924
Species Human (GRCh38) Human (GRCh38)
Location 1:32235065-32235087 1:32235110-32235132
Sequence CCCACAGGCCTCCACCAGGCGCA CCCTCTGGGCGGTGGGAGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 132} {0: 1, 1: 0, 2: 0, 3: 22, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!