ID: 904707483_904707490

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 904707483 904707490
Species Human (GRCh38) Human (GRCh38)
Location 1:32402303-32402325 1:32402338-32402360
Sequence CCCTTGAGGGTGGCCTCCGATGC CTTCTTGATGTCATCATATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 71} {0: 10, 1: 16, 2: 16, 3: 43, 4: 339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!