ID: 904707488_904707495

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 904707488 904707495
Species Human (GRCh38) Human (GRCh38)
Location 1:32402334-32402356 1:32402384-32402406
Sequence CCACCTTCTTGATGTCATCATAT CAGGTCTACAACCCACATGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 3, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!