ID: 904738228_904738233

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 904738228 904738233
Species Human (GRCh38) Human (GRCh38)
Location 1:32651338-32651360 1:32651355-32651377
Sequence CCGACCCAGGAGGGCAGTGGGTG TGGGTGCCTGGGCTGAGCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 655} {0: 1, 1: 0, 2: 4, 3: 49, 4: 481}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!