ID: 904741032_904741035

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 904741032 904741035
Species Human (GRCh38) Human (GRCh38)
Location 1:32676002-32676024 1:32676020-32676042
Sequence CCTTGAATCCAGCGGGTAGAGGC GAGGCTGCTGTGAGACATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 507} {0: 1, 1: 1, 2: 40, 3: 650, 4: 3036}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!