|
Left Crispr |
Right Crispr |
| Crispr ID |
904742425 |
904742431 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:32688674-32688696
|
1:32688704-32688726
|
| Sequence |
CCTTGCGGGTTCAGGCAATTCTG |
CCCCGAGTAGCTGGGATTACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 72, 3: 2052, 4: 28562} |
{0: 781, 1: 48784, 2: 215593, 3: 259482, 4: 188726} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|