ID: 904753620_904753625

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 904753620 904753625
Species Human (GRCh38) Human (GRCh38)
Location 1:32755825-32755847 1:32755853-32755875
Sequence CCTGAAAGCCCTGTCTGTGCCTA CTCTCCTAGAATCTGCACTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 222} {0: 1, 1: 0, 2: 0, 3: 12, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!