ID: 904764405_904764416

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 904764405 904764416
Species Human (GRCh38) Human (GRCh38)
Location 1:32832573-32832595 1:32832617-32832639
Sequence CCCATTGCCCAGTATTCCTACAT ATACCTTATTGCAAGGGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 122} {0: 1, 1: 0, 2: 1, 3: 34, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!