ID: 904775087_904775097

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 904775087 904775097
Species Human (GRCh38) Human (GRCh38)
Location 1:32901431-32901453 1:32901451-32901473
Sequence CCGGCCCCGCAGCGCCCCCGCGG CGGCTCGTGCCCCTCCCGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 82, 4: 676} {0: 1, 1: 0, 2: 0, 3: 11, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!