ID: 904783000_904783007

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 904783000 904783007
Species Human (GRCh38) Human (GRCh38)
Location 1:32964593-32964615 1:32964606-32964628
Sequence CCGGCGCCGGCCGCCGCTGCGGC CCGCTGCGGCACTTAGGGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 90, 4: 791} {0: 1, 1: 0, 2: 0, 3: 2, 4: 34}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!