ID: 904786690_904786694

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 904786690 904786694
Species Human (GRCh38) Human (GRCh38)
Location 1:32988214-32988236 1:32988261-32988283
Sequence CCAGGCTCCAGCTATGTATACAA TTTTTGAGACAGGGTTGCCCAGG
Strand - +
Off-target summary No data {0: 12, 1: 47, 2: 169, 3: 414, 4: 878}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!