ID: 904809070_904809077

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 904809070 904809077
Species Human (GRCh38) Human (GRCh38)
Location 1:33151530-33151552 1:33151557-33151579
Sequence CCCTTCCCCCTCTGAGAAGTCAG TCCATCTGTCCCTCATCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 261} {0: 1, 1: 0, 2: 8, 3: 46, 4: 360}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!