|
Left Crispr |
Right Crispr |
| Crispr ID |
904813291 |
904813298 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:33178146-33178168
|
1:33178166-33178188
|
| Sequence |
CCTTCCTCCCTCTCCCTCTCCTG |
CTGTTTCCCCATCTGTCAAGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 10, 2: 79, 3: 1042, 4: 5976} |
{0: 1, 1: 11, 2: 162, 3: 1226, 4: 5191} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|