ID: 904822833_904822840

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 904822833 904822840
Species Human (GRCh38) Human (GRCh38)
Location 1:33256466-33256488 1:33256497-33256519
Sequence CCGCCGCCTCGGCGCTTGCAGAA TGAACAGCAGGCGACCCGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 55} {0: 1, 1: 0, 2: 0, 3: 10, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!