ID: 904834947_904834961

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 904834947 904834961
Species Human (GRCh38) Human (GRCh38)
Location 1:33329776-33329798 1:33329811-33329833
Sequence CCAGGGGAGACCCCATTTCCGTG AAGGATGGAGGCAAACTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 184} {0: 1, 1: 0, 2: 0, 3: 42, 4: 410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!