ID: 904842205_904842207

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 904842205 904842207
Species Human (GRCh38) Human (GRCh38)
Location 1:33379659-33379681 1:33379675-33379697
Sequence CCATCCTCAGTGTGCTCACCCTC CACCCTCCCTCACTCTGCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 342} {0: 1, 1: 2, 2: 7, 3: 82, 4: 550}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!