ID: 904847475_904847489

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 904847475 904847489
Species Human (GRCh38) Human (GRCh38)
Location 1:33430948-33430970 1:33431000-33431022
Sequence CCCCAGCGCGCACGCGCCCGCCC TCCACCTGGCCGCTCTCTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 39, 4: 322} {0: 1, 1: 0, 2: 0, 3: 21, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!