ID: 904851639_904851649

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 904851639 904851649
Species Human (GRCh38) Human (GRCh38)
Location 1:33463947-33463969 1:33464000-33464022
Sequence CCACTTCCTCCCAGAGGAGTTGT CTAACGGATGTCCCTTCACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 257} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!