ID: 904851644_904851649

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 904851644 904851649
Species Human (GRCh38) Human (GRCh38)
Location 1:33463956-33463978 1:33464000-33464022
Sequence CCCAGAGGAGTTGTGAAGGGGTG CTAACGGATGTCCCTTCACATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!