ID: 904858411_904858422

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 904858411 904858422
Species Human (GRCh38) Human (GRCh38)
Location 1:33517229-33517251 1:33517266-33517288
Sequence CCAGCTGTGGGCAGAAGTGGTCA GAGACCTGTGGGCTGGGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 234} {0: 1, 1: 0, 2: 5, 3: 65, 4: 559}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!