ID: 904863754_904863764

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 904863754 904863764
Species Human (GRCh38) Human (GRCh38)
Location 1:33560406-33560428 1:33560437-33560459
Sequence CCTGCATCCCTCTGATTCCCCCT GTGGTATAGCTCACTCTATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 343} {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!