ID: 904863754_904863767

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 904863754 904863767
Species Human (GRCh38) Human (GRCh38)
Location 1:33560406-33560428 1:33560457-33560479
Sequence CCTGCATCCCTCTGATTCCCCCT TGGCTGCACTGGCCTCTTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 343} {0: 1, 1: 0, 2: 3, 3: 25, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!