ID: 904869427_904869430

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 904869427 904869430
Species Human (GRCh38) Human (GRCh38)
Location 1:33607460-33607482 1:33607488-33607510
Sequence CCTGGGGAGAGTGGTCAGAGCTT CGAGGTGCCGCTCCGTACGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 170} {0: 1, 1: 0, 2: 0, 3: 1, 4: 9}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!