ID: 904893942_904893949

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 904893942 904893949
Species Human (GRCh38) Human (GRCh38)
Location 1:33800139-33800161 1:33800178-33800200
Sequence CCACCCAGCCTCAGTTTACAATG TATTAGCTCCATGAAAGGAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 235} {0: 1, 1: 0, 2: 3, 3: 49, 4: 360}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!