|
Left Crispr |
Right Crispr |
| Crispr ID |
904897912 |
904897915 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:33831084-33831106
|
1:33831108-33831130
|
| Sequence |
CCTGCAGGATACTATCCAGGAGA |
CTTCTCCAATCTAGCAAGGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 38, 2: 52, 3: 34, 4: 134} |
{0: 41, 1: 3848, 2: 2692, 3: 2296, 4: 1552} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|