ID: 904900914_904900916

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 904900914 904900916
Species Human (GRCh38) Human (GRCh38)
Location 1:33856366-33856388 1:33856381-33856403
Sequence CCTCTTTCTCTGGGGAACCCCAG AACCCCAGCCTGGCCTCCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 408} {0: 1, 1: 0, 2: 3, 3: 42, 4: 445}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!