ID: 904905688_904905690

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 904905688 904905690
Species Human (GRCh38) Human (GRCh38)
Location 1:33895744-33895766 1:33895768-33895790
Sequence CCCTAGGCATGGGATGCAGGCTG TCCCAGCCCCCATGAGTTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 193} {0: 1, 1: 0, 2: 0, 3: 23, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!