ID: 904907043_904907047

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 904907043 904907047
Species Human (GRCh38) Human (GRCh38)
Location 1:33905361-33905383 1:33905393-33905415
Sequence CCAGCTACATGGTTTCATAGGAG GGAAATAGTTCAAGAAGGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 107} {0: 1, 1: 0, 2: 0, 3: 43, 4: 654}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!