ID: 904910733_904910747

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 904910733 904910747
Species Human (GRCh38) Human (GRCh38)
Location 1:33932345-33932367 1:33932376-33932398
Sequence CCCCAGAGAAGAGGCCGAGCTGG GTATTTAAGGGGAATGAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 226} {0: 1, 1: 0, 2: 4, 3: 20, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!