ID: 904937328_904937336

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 904937328 904937336
Species Human (GRCh38) Human (GRCh38)
Location 1:34140935-34140957 1:34140960-34140982
Sequence CCCTCCAGCCTCACTTCCTGCAG CCAGCCACCACACACACACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 79, 4: 645} {0: 1, 1: 0, 2: 10, 3: 58, 4: 455}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!