ID: 904948148_904948153

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 904948148 904948153
Species Human (GRCh38) Human (GRCh38)
Location 1:34214382-34214404 1:34214424-34214446
Sequence CCAGGGAAGATTTATGCACATCA AAGTAAGAGAAAGAGGAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 135} {0: 1, 1: 1, 2: 14, 3: 164, 4: 1744}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!