ID: 904970077_904970081

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 904970077 904970081
Species Human (GRCh38) Human (GRCh38)
Location 1:34412618-34412640 1:34412643-34412665
Sequence CCTCTCTTTATGTTGACGAGGGA TATCTAGAGAGATGGGAGATGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!