ID: 905004411_905004418

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 905004411 905004418
Species Human (GRCh38) Human (GRCh38)
Location 1:34698359-34698381 1:34698404-34698426
Sequence CCTTCTAGATACAGGTGTCAGAG TACAGATGAGAAAACTGAGAGGG
Strand - +
Off-target summary No data {0: 2, 1: 11, 2: 83, 3: 227, 4: 761}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!