ID: 905005504_905005507

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 905005504 905005507
Species Human (GRCh38) Human (GRCh38)
Location 1:34706438-34706460 1:34706475-34706497
Sequence CCAAAGGAGTTAAGGAGAGCAAA CAGTGAATCCAGAGGCAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 224} {0: 1, 1: 0, 2: 5, 3: 20, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!