ID: 905008868_905008871

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 905008868 905008871
Species Human (GRCh38) Human (GRCh38)
Location 1:34733241-34733263 1:34733267-34733289
Sequence CCTTGAACAAGTTGTTTATCCTC GTGCCTTTGTCTGTGAAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 32, 3: 247, 4: 1314} {0: 1, 1: 0, 2: 3, 3: 15, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!