ID: 905008868_905008874

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 905008868 905008874
Species Human (GRCh38) Human (GRCh38)
Location 1:34733241-34733263 1:34733293-34733315
Sequence CCTTGAACAAGTTGTTTATCCTC ATGATAATACCTACTTCAATGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 32, 3: 247, 4: 1314} {0: 1, 1: 1, 2: 10, 3: 114, 4: 671}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!