ID: 905008872_905008873

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 905008872 905008873
Species Human (GRCh38) Human (GRCh38)
Location 1:34733270-34733292 1:34733292-34733314
Sequence CCTTTGTCTGTGAAGCAGGGTTA AATGATAATACCTACTTCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 202} {0: 1, 1: 4, 2: 51, 3: 348, 4: 1437}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!